Forensic epistemology: A need for research and pedagogy.

This is the third in a series of articles reporting on forensic epistemology. Our first two research articles presented scientific results that are based in experimental design; including quantitative and qualitative responses from forensic science practitioners to scenarios and evidence.

Human Angiotensinogen (AGT) ELISA Kit
DL-AGT-Hu-96	DLdevelop	1 kit of 96 tests	EUR 526.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Angiotensinogen (AGT)

Mouse Angiotensinogen (AGT) ELISA Kit
DL-AGT-Mu-192	DLdevelop	1 kit of 192 tests	EUR 938.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Angiotensinogen (AGT)

Mouse Angiotensinogen (AGT) ELISA Kit
DL-AGT-Mu-48	DLdevelop	1 kit of 48 tests	EUR 407.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Angiotensinogen (AGT)

Mouse Angiotensinogen (AGT) ELISA Kit
DL-AGT-Mu-96	DLdevelop	1 kit of 96 tests	EUR 539.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Angiotensinogen (AGT)

Rat Angiotensinogen (AGT) ELISA Kit
DL-AGT-Ra-192	DLdevelop	1 kit of 192 tests	EUR 989.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Angiotensinogen (AGT)

Rat Angiotensinogen (AGT) ELISA Kit
DL-AGT-Ra-48	DLdevelop	1 kit of 48 tests	EUR 425.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Angiotensinogen (AGT)

Rat Angiotensinogen (AGT) ELISA Kit
DL-AGT-Ra-96	DLdevelop	1 kit of 96 tests	EUR 564.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Angiotensinogen (AGT)

Human Angiotensinogen (AGT) ELISA Kit
DLR-AGT-Hu-48T	DL Develop	48T	EUR 425.00
Should the Human Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiotensinogen (AGT) in samples from serum, plasma, urine, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiotensinogen (AGT) ELISA Kit
DLR-AGT-Hu-96T	DL Develop	96T	EUR 548.00
Should the Human Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiotensinogen (AGT) in samples from serum, plasma, urine, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Angiotensinogen (AGT) ELISA Kit
DLR-AGT-Mu-48T	DL Develop	48T	EUR 435.00
Should the Mouse Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Angiotensinogen (AGT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Angiotensinogen (AGT) ELISA Kit
DLR-AGT-Mu-96T	DL Develop	96T	EUR 561.00
Should the Mouse Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Angiotensinogen (AGT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Angiotensinogen (AGT) ELISA Kit
DLR-AGT-Ra-48T	DL Develop	48T	EUR 454.00
Should the Rat Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiotensinogen (AGT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Angiotensinogen (AGT) ELISA Kit
DLR-AGT-Ra-96T	DL Develop	96T	EUR 587.00
Should the Rat Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiotensinogen (AGT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Angiotensinogen (AGT) ELISA Kit
RD-AGT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 418.00

Human Angiotensinogen (AGT) ELISA Kit
RD-AGT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 575.00

Mouse Angiotensinogen (AGT) ELISA Kit
RD-AGT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 429.00

Mouse Angiotensinogen (AGT) ELISA Kit
RD-AGT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 591.00

Rat Angiotensinogen (AGT) ELISA Kit
RD-AGT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 450.00

Rat Angiotensinogen (AGT) ELISA Kit
RD-AGT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 622.00

Human Angiotensinogen (AGT) ELISA Kit
RDR-AGT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436.00

Human Angiotensinogen (AGT) ELISA Kit
RDR-AGT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601.00

Mouse Angiotensinogen (AGT) ELISA Kit
RDR-AGT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 447.00

Mouse Angiotensinogen (AGT) ELISA Kit
RDR-AGT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 618.00

Rat Angiotensinogen (AGT) ELISA Kit
RDR-AGT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 470.00

Rat Angiotensinogen (AGT) ELISA Kit
RDR-AGT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 651.00

aGT/ Rat aGT ELISA Kit
ELA-E0797r	Lifescience Market	96 Tests	EUR 886.00

Agt/ Rat Agt ELISA Kit
ELI-02702r	Lifescience Market	96 Tests	EUR 886.00

AGT siRNA
20-abx907049	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AGT siRNA
20-abx907050	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AGT antibody
10R-1811	Fitzgerald	100 ul	EUR 403.00
Description: Mouse monoclonal AGT antibody

AGT antibody
38789-100ul	SAB	100ul	EUR 252.00

AGT antibody
70R-6214	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal AGT antibody

AGT Antibody
ABD7976	Lifescience Market	100 ug	EUR 438.00

AGT Antibody
ABD8022	Lifescience Market	100 ug	EUR 438.00

AGT Antibody
ABD8094	Lifescience Market	100 ug	EUR 438.00

AGT Antibody
1-CSB-PA446811	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

AGT Antibody
1-CSB-PA693559	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:1000-1:5000, IHC:1:25-1:100

AGT Antibody
1-CSB-PA959270	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

AGT Antibody
1-CSB-PA982509	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

AGT Antibody
1-CSB-PA001463EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

AGT Antibody
1-CSB-PA001463ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AGT Antibody
1-CSB-PA001463ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

AGT Antibody
1-CSB-PA001463GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

AGT Antibody
36739-100ul	SAB	100ul	EUR 252.00

AGT antibody
70R-14180	Fitzgerald	100 ug	EUR 322.00
Description: Affinity purified Rabbit polyclonal AGT antibody

AGT antibody
70R-15631	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal AGT antibody

AGT Antibody
1-CSB-PA173097	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA;ELISA:1:1000-1:2000

AGT Antibody
1-CSB-PA090852	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

AGT Antibody
1-CSB-PA10079A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:400, IF:1:50-1:200, IP:1:200-1:2000

AGT Antibody
1-CSB-PA281661	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

AGT Antibody
BF0069	Affbiotech	200ul	EUR 376.00
Description: AGT antibody detects endogenous levels of total AGT.

AGT Antibody
DF7976	Affbiotech	200ul	EUR 304.00
Description: AGT Antibody detects endogenous levels of total AGT.

Angiotensinogen (AGT) Antibody
20-abx171240	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Angiotensinogen (AGT) Antibody
20-abx214416	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx211344	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
abx230393-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody
abx230394-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody
abx230395-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody
20-abx242324	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx241726	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx241946	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx241947	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
abx010360-100ul	Abbexa	100 ul	EUR 411.00
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx004798	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
abx033720-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
abx033720-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
abx033721-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
abx033721-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx301357	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx320213	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx322250	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx339646	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

AGT Polyclonal Antibody
A50656	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

AGT Polyclonal Antibody
E-AB-70276-120uL	Elabscience Biotechnology	120uL	EUR 253.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol. Purified by: Affinity purification Background: Angiotensinogen is a precursor of angiotensin II (Ang II),is expressed and synthesized larg Show more
Description: Rabbit antibody against Mouse,Rat AGT for WB applications.

AGT Polyclonal Antibody
E-AB-70276-200uL	Elabscience Biotechnology	200uL	EUR 400.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol. Purified by: Affinity purification Background: Angiotensinogen is a precursor of angiotensin II (Ang II),is expressed and synthesized larg Show more
Description: Rabbit antibody against Mouse,Rat AGT for WB applications.

AGT Polyclonal Antibody
E-AB-70276-60uL	Elabscience Biotechnology	60uL	EUR 182.00
Conjugation: Unconjugated Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol. Purified by: Affinity purification Background: Angiotensinogen is a precursor of angiotensin II (Ang II),is expressed and synthesized larg Show more
Description: Rabbit antibody against Mouse,Rat AGT for WB applications.

AGT Polyclonal Antibody
E-AB-12716-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the l Show more
Description: Rabbit antibody against Human,Mouse,Rat AGT for WB,IHC,ELISA applications.

AGT Polyclonal Antibody
E-AB-12716-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the l Show more
Description: Rabbit antibody against Human,Mouse,Rat AGT for WB,IHC,ELISA applications.

AGT Polyclonal Antibody
E-AB-12716-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the l Show more
Description: Rabbit antibody against Human,Mouse,Rat AGT for WB,IHC,ELISA applications.

Eukaryotic Angiotensinogen (AGT)
4-EPA797Mu61	Cloud-Clone	EUR 466.46 EUR 228.00 EUR 1474.24 EUR 558.08 EUR 1016.16 EUR 375.00 EUR 3535.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P11859 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.2kDa Isoelectric Point: 5.0
Description: Recombinant Mouse Angiotensinogen expressed in: 293F cell

Eukaryotic Angiotensinogen (AGT)
4-EPA797Ra61	Cloud-Clone	EUR 471.84 EUR 229.00 EUR 1494.40 EUR 564.80 EUR 1029.60 EUR 379.00 EUR 3586.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P01015 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.2kDa Isoelectric Point: 5.3
Description: Recombinant Rat Angiotensinogen expressed in: 293F cell

AGT Blocking Peptide
33R-3985	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGT antibody, catalog no. 70R-6214

AGT Antibody (CT)
6708-100	Biovision		EUR 316.00

AGT Antibody (NT)
6709-100	Biovision		EUR 316.00

Angiotensinogen (AGT) Antibody
20-abx175400	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

AGT cloning plasmid
CSB-CL001463HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1458 Sequence: atgcggaagcgagcaccccagtctgagatggctcctgccggtgtgagcctgagggccaccatcctctgcctcctggcctgggctggcctggctgcaggtgaccgggtgtacatacaccccttccacctcgtcatccacaatgagagtacctgtgagcagctggcaaaggccaatg Show more
Description: A cloning plasmid for the AGT gene.

AGT Conjugated Antibody
C38789	SAB	100ul	EUR 397.00

AGT Conjugated Antibody
C36739	SAB	100ul	EUR 397.00

Angiotensinogen (AGT) Antibody
20-abx128540	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody
20-abx110982	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody
20-abx101137	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody
20-abx101138	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody
20-abx101139	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody
20-abx101140	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Human Angiotensinogen (AGT)
1-CSB-EP001463HU1	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 57.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Angiotensinogen(AGT),partial expressed in E.coli

anti-AGT (1B1)
LF-MA30300	Abfrontier	100 ul	EUR 486.00
Description: Mouse Monoclonal to AGT

pCMV-SPORT6-AGT
PVT12942	Lifescience Market	2 ug	EUR 391.00

pCMV-SPORT6-AGT
PVT13051	Lifescience Market	2 ug	EUR 391.00

Temozolomide (AGT inhibitor)
SIH-363-100MG	Stressmarq	100 mg	EUR 324.00
Temozolomide is a membrane permeable DNA alkylating agent which acts as an anti-tumor and anti-angiogenic agent by alkylating the N-7 or O-6 positions of guanine residues which triggers tumor cell death (1-2). It has been used clinically as an anti-c Show more
Description: The substance Temozolomide is a agt inhibitor. It is synthetically produced and has a purity of ?99%. The pure substance is off white powder which is soluble in DMSO (25 mg/ml, warm) or water (weakly).

Temozolomide (AGT inhibitor)
SIH-363-25MG	Stressmarq	25 mg	EUR 155.00
Temozolomide is a membrane permeable DNA alkylating agent which acts as an anti-tumor and anti-angiogenic agent by alkylating the N-7 or O-6 positions of guanine residues which triggers tumor cell death (1-2). It has been used clinically as an anti-c Show more
Description: The substance Temozolomide is a agt inhibitor. It is synthetically produced and has a purity of ?99%. The pure substance is off white powder which is soluble in DMSO (25 mg/ml, warm) or water (weakly).

AGT Blocking Peptide
BF0069-BP	Affbiotech	1mg	EUR 195.00

Recombinant Angiotensinogen (AGT)
4-RPA797Hu01	Cloud-Clone	EUR 535.46 EUR 246.00 EUR 1732.96 EUR 644.32 EUR 1188.64 EUR 421.00 EUR 4182.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P01019 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.5kDa Isoelectric Point: 6.1
Description: Recombinant Human Angiotensinogen expressed in: E.coli

Recombinant Angiotensinogen (AGT)
4-RPA797Hu02	Cloud-Clone	EUR 535.46 EUR 246.00 EUR 1732.96 EUR 644.32 EUR 1188.64 EUR 421.00 EUR 4182.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P01019 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 76.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Angiotensinogen expressed in: E.coli

Recombinant Angiotensinogen (AGT)
4-RPA797Mu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P11859 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 56.1kDa Isoelectric Point: 5.4
Description: Recombinant Mouse Angiotensinogen expressed in: E.coli

Recombinant Angiotensinogen (AGT)
4-RPA797Ra01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P01015 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 55.3kDa Isoelectric Point: 5.4
Description: Recombinant Rat Angiotensinogen expressed in: E.coli

AGT Blocking Peptide
DF7976-BP	Affbiotech	1mg	EUR 195.00

AGT Rabbit pAb
A15637-100ul	Abclonal	100 ul	EUR 308.00

AGT Rabbit pAb
A15637-200ul	Abclonal	200 ul	EUR 459.00

AGT Rabbit pAb
A15637-20ul	Abclonal	20 ul	EUR 183.00

AGT Rabbit pAb
A15637-50ul	Abclonal	50 ul	EUR 223.00

Anti-AGT antibody
STJ118098	St John's Laboratory	100 µl	EUR 277.00

Anti-AGT antibody
STJ28201	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease.

Anti-AGT antibody
STJ97818	St John's Laboratory	100 µl	EUR 234.00
Description: Mouse monoclonal to AGT.

Human Angiotensinogen (AGT) Protein
20-abx065351	Abbexa	EUR 746.00 EUR 300.00 EUR 2332.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Angiotensinogen (AGT) Protein
20-abx065352	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Angiotensinogen (AGT) Protein
20-abx065353	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Angiotensinogen (AGT) Protein
20-abx065354	Abbexa	EUR 746.00 EUR 300.00 EUR 2332.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody (HRP)
20-abx306453	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody (FITC)
20-abx306454	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody (Biotin)
20-abx306455	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody (Biotin)
20-abx272741	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Angiotensinogen (AGT) Antibody (Biotin)
20-abx273211	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Angiotensinogen (AGT) Antibody (FITC)
20-abx273972	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Angiotensinogen (AGT) Antibody (FITC)
20-abx274115	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Angiotensinogen (AGT) Protein
20-abx651467	Abbexa	EUR 648.00 EUR 272.00 EUR 1984.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Angiotensinogen (AGT) Protein
20-abx651468	Abbexa	EUR 662.00 EUR 272.00 EUR 2012.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human AGT shRNA Plasmid
20-abx950129	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

AGT/Angiotensin-1 Antibody
47494-100ul	SAB	100ul	EUR 252.00

Anti-Angiotensinogen/AGT Antibody
A02103-1	BosterBio	100ug/vial	EUR 334.00

Human AGT ELISA Kit
ELA-E0797h	Lifescience Market	96 Tests	EUR 824.00

AGT ELISA KIT|Human
EF000352	Lifescience Market	96 Tests	EUR 689.00

AGT Antibody, HRP conjugated
1-CSB-PA001463EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AGT Antibody, FITC conjugated
1-CSB-PA001463EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AGT Antibody, Biotin conjugated
1-CSB-PA001463ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat AGT shRNA Plasmid
20-abx984365	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Angiotensinogen (AGT) Antibody Pair
20-abx370425	Abbexa	EUR 1595.00 EUR 1024.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Angiotensinogen (AGT) Antibody Pair
20-abx370604	Abbexa	EUR 1706.00 EUR 1094.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

AGT Antibody, HRP conjugated
1-CSB-PA10079B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AGT Antibody, FITC conjugated
1-CSB-PA10079C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AGT Antibody, Biotin conjugated
1-CSB-PA10079D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

AGT Recombinant Protein (Human)
RP000778	ABM	100 ug	Ask for price

Bovine AGT ELISA Kit
EBA0504	Abclonal	96Tests	EUR 521.00

Anserini AGT ELISA Kit
EAA0504	Abclonal	96Tests	EUR 521.00

Anti-Angiotensinogen/AGT Antibody
PA1643	BosterBio	100ug/vial	EUR 294.00

AGT Recombinant Protein (Mouse)
RP114833	ABM	100 ug	Ask for price

AGT Recombinant Protein (Rat)
RP189563	ABM	100 ug	Ask for price

Chicken AGT ELISA Kit
ECKA0504	Abclonal	96Tests	EUR 521.00

Canine AGT ELISA Kit
ECA0504	Abclonal	96Tests	EUR 521.00

Rat AGT ELISA Kit
ERA0504	Abclonal	96Tests	EUR 521.00

Sheep AGT ELISA Kit
ESA0504	Abclonal	96Tests	EUR 521.00

Rabbit AGT ELISA Kit
ERTA0504	Abclonal	96Tests	EUR 521.00

Human AGT ELISA Kit
EHA0504	Abclonal	96Tests	EUR 521.00

Mouse AGT ELISA Kit
EMA0504	Abclonal	96Tests	EUR 521.00

Porcine AGT ELISA Kit
EPA0504	Abclonal	96Tests	EUR 521.00

Monkey AGT ELISA Kit
EMKA0504	Abclonal	96Tests	EUR 521.00

Goat AGT ELISA Kit
EGTA0504	Abclonal	96Tests	EUR 521.00

Rat AGT ELISA Kit
STJ150346	St John's Laboratory	1 kit	EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of AGT in Rat serum, plasma and other biological fluids

Polyclonal AGT Antibody (CT)
APG01610G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AGT (CT). This antibody is tested and proven to work in the following applications:

Anti-AGXT / AGT antibody
STJ71786	St John's Laboratory	100 µg	EUR 260.00

Human Angiotensinogen (AGT) CLIA Kit
20-abx190340	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Angiotensinogen (AGT) CLIA Kit
20-abx190577	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Angiotensinogen (AGT) CLIA Kit
abx195128-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Mouse Angiotensinogen (AGT) CLIA Kit
abx195129-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Rat Angiotensinogen (AGT) CLIA Kit
abx195130-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Based on a synthesis of this research there is evidence of a knowledge gap in formal reasoning for some forensic practitioners, and a limited understanding of case-specific research. Combining these results with a review of the current literature in the field of forensic reasoning, we now offer evidence of teaching and research strategies that can help increase the epistemic status (Confidence in, and justification of knowledge) of forensic science claims