Forensic epistemology: A need for research and pedagogy.

This is the third in a series of articles reporting on forensic epistemology. Our first two research articles presented scientific results that are based in experimental design; including quantitative and qualitative responses from forensic science practitioners to scenarios and evidence.

Human Angiotensinogen (AGT) ELISA Kit

DL-AGT-Hu-96 1 kit of 96 tests
EUR 526.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Angiotensinogen (AGT)

Mouse Angiotensinogen (AGT) ELISA Kit

DL-AGT-Mu-192 1 kit of 192 tests
EUR 938.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Angiotensinogen (AGT)

Mouse Angiotensinogen (AGT) ELISA Kit

DL-AGT-Mu-48 1 kit of 48 tests
EUR 407.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Angiotensinogen (AGT)

Mouse Angiotensinogen (AGT) ELISA Kit

DL-AGT-Mu-96 1 kit of 96 tests
EUR 539.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Angiotensinogen (AGT)

Rat Angiotensinogen (AGT) ELISA Kit

DL-AGT-Ra-192 1 kit of 192 tests
EUR 989.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Angiotensinogen (AGT)

Rat Angiotensinogen (AGT) ELISA Kit

DL-AGT-Ra-48 1 kit of 48 tests
EUR 425.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Angiotensinogen (AGT)

Rat Angiotensinogen (AGT) ELISA Kit

DL-AGT-Ra-96 1 kit of 96 tests
EUR 564.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Angiotensinogen (AGT)

Human Angiotensinogen (AGT) ELISA Kit

DLR-AGT-Hu-48T 48T
EUR 425.00
  • Should the Human Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiotensinogen (AGT) in samples from serum, plasma, urine, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Angiotensinogen (AGT) ELISA Kit

DLR-AGT-Hu-96T 96T
EUR 548.00
  • Should the Human Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Angiotensinogen (AGT) in samples from serum, plasma, urine, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Angiotensinogen (AGT) ELISA Kit

DLR-AGT-Mu-48T 48T
EUR 435.00
  • Should the Mouse Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Angiotensinogen (AGT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Angiotensinogen (AGT) ELISA Kit

DLR-AGT-Mu-96T 96T
EUR 561.00
  • Should the Mouse Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Angiotensinogen (AGT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Angiotensinogen (AGT) ELISA Kit

DLR-AGT-Ra-48T 48T
EUR 454.00
  • Should the Rat Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiotensinogen (AGT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Angiotensinogen (AGT) ELISA Kit

DLR-AGT-Ra-96T 96T
EUR 587.00
  • Should the Rat Angiotensinogen (AGT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Angiotensinogen (AGT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Angiotensinogen (AGT) ELISA Kit

RD-AGT-Hu-48Tests 48 Tests
EUR 418.00

Human Angiotensinogen (AGT) ELISA Kit

RD-AGT-Hu-96Tests 96 Tests
EUR 575.00

Mouse Angiotensinogen (AGT) ELISA Kit

RD-AGT-Mu-48Tests 48 Tests
EUR 429.00

Mouse Angiotensinogen (AGT) ELISA Kit

RD-AGT-Mu-96Tests 96 Tests
EUR 591.00

Rat Angiotensinogen (AGT) ELISA Kit

RD-AGT-Ra-48Tests 48 Tests
EUR 450.00

Rat Angiotensinogen (AGT) ELISA Kit

RD-AGT-Ra-96Tests 96 Tests
EUR 622.00

Human Angiotensinogen (AGT) ELISA Kit

RDR-AGT-Hu-48Tests 48 Tests
EUR 436.00

Human Angiotensinogen (AGT) ELISA Kit

RDR-AGT-Hu-96Tests 96 Tests
EUR 601.00

Mouse Angiotensinogen (AGT) ELISA Kit

RDR-AGT-Mu-48Tests 48 Tests
EUR 447.00

Mouse Angiotensinogen (AGT) ELISA Kit

RDR-AGT-Mu-96Tests 96 Tests
EUR 618.00

Rat Angiotensinogen (AGT) ELISA Kit

RDR-AGT-Ra-48Tests 48 Tests
EUR 470.00

Rat Angiotensinogen (AGT) ELISA Kit

RDR-AGT-Ra-96Tests 96 Tests
EUR 651.00

aGT/ Rat aGT ELISA Kit

ELA-E0797r 96 Tests
EUR 886.00

Agt/ Rat Agt ELISA Kit

ELI-02702r 96 Tests
EUR 886.00

AGT siRNA

20-abx907049
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AGT siRNA

20-abx907050
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AGT antibody

10R-1811 100 ul
EUR 403.00
Description: Mouse monoclonal AGT antibody

AGT antibody

38789-100ul 100ul
EUR 252.00

AGT antibody

70R-6214 50 ug
EUR 467.00
Description: Rabbit polyclonal AGT antibody

AGT Antibody

ABD7976 100 ug
EUR 438.00

AGT Antibody

ABD8022 100 ug
EUR 438.00

AGT Antibody

ABD8094 100 ug
EUR 438.00

AGT Antibody

1-CSB-PA446811
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

AGT Antibody

1-CSB-PA693559
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:1000-1:5000, IHC:1:25-1:100

AGT Antibody

1-CSB-PA959270
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

AGT Antibody

1-CSB-PA982509
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

AGT Antibody

1-CSB-PA001463EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

AGT Antibody

1-CSB-PA001463ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AGT Antibody

1-CSB-PA001463ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

AGT Antibody

1-CSB-PA001463GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

AGT Antibody

36739-100ul 100ul
EUR 252.00

AGT antibody

70R-14180 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal AGT antibody

AGT antibody

70R-15631 50 ul
EUR 435.00
Description: Rabbit polyclonal AGT antibody

AGT Antibody

1-CSB-PA173097
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA;ELISA:1:1000-1:2000

AGT Antibody

1-CSB-PA090852
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

AGT Antibody

1-CSB-PA10079A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:400, IF:1:50-1:200, IP:1:200-1:2000

AGT Antibody

1-CSB-PA281661
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

AGT Antibody

BF0069 200ul
EUR 376.00
Description: AGT antibody detects endogenous levels of total AGT.

AGT Antibody

DF7976 200ul
EUR 304.00
Description: AGT Antibody detects endogenous levels of total AGT.

Angiotensinogen (AGT) Antibody

20-abx171240
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Angiotensinogen (AGT) Antibody

20-abx214416
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx211344
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

abx230393-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody

abx230394-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody

abx230395-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody

20-abx242324
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx241726
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx241946
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx241947
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

abx010360-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx004798
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

abx033720-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

abx033720-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

abx033721-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

abx033721-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx301357
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx320213
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx322250
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx339646
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

AGT Polyclonal Antibody

A50656 100 µg
EUR 570.55
Description: The best epigenetics products

AGT Polyclonal Antibody

E-AB-70276-120uL 120uL
EUR 253.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: Angiotensinogen is a precursor of angiotensin II (Ang II),is expressed and synthesized larg
  • Show more
Description: Rabbit antibody against Mouse,Rat AGT for WB applications.

AGT Polyclonal Antibody

E-AB-70276-200uL 200uL
EUR 400.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: Angiotensinogen is a precursor of angiotensin II (Ang II),is expressed and synthesized larg
  • Show more
Description: Rabbit antibody against Mouse,Rat AGT for WB applications.

AGT Polyclonal Antibody

E-AB-70276-60uL 60uL
EUR 182.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,100 μg/ml BSA and 50% glycerol.
  • Purified by: Affinity purification
  • Background: Angiotensinogen is a precursor of angiotensin II (Ang II),is expressed and synthesized larg
  • Show more
Description: Rabbit antibody against Mouse,Rat AGT for WB applications.

AGT Polyclonal Antibody

E-AB-12716-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the l
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat AGT for WB,IHC,ELISA applications.

AGT Polyclonal Antibody

E-AB-12716-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the l
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat AGT for WB,IHC,ELISA applications.

AGT Polyclonal Antibody

E-AB-12716-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the l
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat AGT for WB,IHC,ELISA applications.

Eukaryotic Angiotensinogen (AGT)

4-EPA797Mu61
  • EUR 466.46
  • EUR 228.00
  • EUR 1474.24
  • EUR 558.08
  • EUR 1016.16
  • EUR 375.00
  • EUR 3535.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11859
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.2kDa
  • Isoelectric Point: 5.0
Description: Recombinant Mouse Angiotensinogen expressed in: 293F cell

Eukaryotic Angiotensinogen (AGT)

4-EPA797Ra61
  • EUR 471.84
  • EUR 229.00
  • EUR 1494.40
  • EUR 564.80
  • EUR 1029.60
  • EUR 379.00
  • EUR 3586.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01015
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.2kDa
  • Isoelectric Point: 5.3
Description: Recombinant Rat Angiotensinogen expressed in: 293F cell

AGT Blocking Peptide

33R-3985 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AGT antibody, catalog no. 70R-6214

AGT Antibody (CT)

6708-100
EUR 316.00

AGT Antibody (NT)

6709-100
EUR 316.00

Angiotensinogen (AGT) Antibody

20-abx175400
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

AGT cloning plasmid

CSB-CL001463HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1458
  • Sequence: atgcggaagcgagcaccccagtctgagatggctcctgccggtgtgagcctgagggccaccatcctctgcctcctggcctgggctggcctggctgcaggtgaccgggtgtacatacaccccttccacctcgtcatccacaatgagagtacctgtgagcagctggcaaaggccaatg
  • Show more
Description: A cloning plasmid for the AGT gene.

AGT Conjugated Antibody

C38789 100ul
EUR 397.00

AGT Conjugated Antibody

C36739 100ul
EUR 397.00

Angiotensinogen (AGT) Antibody

20-abx128540
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody

20-abx110982
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody

20-abx101137
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody

20-abx101138
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody

20-abx101139
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody

20-abx101140
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Angiotensinogen (AGT)

1-CSB-EP001463HU1
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 57.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Angiotensinogen(AGT),partial expressed in E.coli

anti-AGT (1B1)

LF-MA30300 100 ul
EUR 486.00
Description: Mouse Monoclonal to AGT

pCMV-SPORT6-AGT

PVT12942 2 ug
EUR 391.00

pCMV-SPORT6-AGT

PVT13051 2 ug
EUR 391.00

Temozolomide (AGT inhibitor)

SIH-363-100MG 100 mg
EUR 324.00
  • Temozolomide is a membrane permeable DNA alkylating agent which acts as an anti-tumor and anti-angiogenic agent by alkylating the N-7 or O-6 positions of guanine residues which triggers tumor cell death (1-2). It has been used clinically as an anti-c
  • Show more
Description: The substance Temozolomide is a agt inhibitor. It is synthetically produced and has a purity of ?99%. The pure substance is off white powder which is soluble in DMSO (25 mg/ml, warm) or water (weakly).

Temozolomide (AGT inhibitor)

SIH-363-25MG 25 mg
EUR 155.00
  • Temozolomide is a membrane permeable DNA alkylating agent which acts as an anti-tumor and anti-angiogenic agent by alkylating the N-7 or O-6 positions of guanine residues which triggers tumor cell death (1-2). It has been used clinically as an anti-c
  • Show more
Description: The substance Temozolomide is a agt inhibitor. It is synthetically produced and has a purity of ?99%. The pure substance is off white powder which is soluble in DMSO (25 mg/ml, warm) or water (weakly).

AGT Blocking Peptide

BF0069-BP 1mg
EUR 195.00

Recombinant Angiotensinogen (AGT)

4-RPA797Hu01
  • EUR 535.46
  • EUR 246.00
  • EUR 1732.96
  • EUR 644.32
  • EUR 1188.64
  • EUR 421.00
  • EUR 4182.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01019
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.5kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Angiotensinogen expressed in: E.coli

Recombinant Angiotensinogen (AGT)

4-RPA797Hu02
  • EUR 535.46
  • EUR 246.00
  • EUR 1732.96
  • EUR 644.32
  • EUR 1188.64
  • EUR 421.00
  • EUR 4182.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01019
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 76.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Angiotensinogen expressed in: E.coli

Recombinant Angiotensinogen (AGT)

4-RPA797Mu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11859
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.1kDa
  • Isoelectric Point: 5.4
Description: Recombinant Mouse Angiotensinogen expressed in: E.coli

Recombinant Angiotensinogen (AGT)

4-RPA797Ra01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01015
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 55.3kDa
  • Isoelectric Point: 5.4
Description: Recombinant Rat Angiotensinogen expressed in: E.coli

AGT Blocking Peptide

DF7976-BP 1mg
EUR 195.00

AGT Rabbit pAb

A15637-100ul 100 ul
EUR 308.00

AGT Rabbit pAb

A15637-200ul 200 ul
EUR 459.00

AGT Rabbit pAb

A15637-20ul 20 ul
EUR 183.00

AGT Rabbit pAb

A15637-50ul 50 ul
EUR 223.00

Anti-AGT antibody

STJ118098 100 µl
EUR 277.00

Anti-AGT antibody

STJ28201 100 µl
EUR 277.00
Description: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease.

Anti-AGT antibody

STJ97818 100 µl
EUR 234.00
Description: Mouse monoclonal to AGT.

Human Angiotensinogen (AGT) Protein

20-abx065351
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Angiotensinogen (AGT) Protein

20-abx065352
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Angiotensinogen (AGT) Protein

20-abx065353
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Angiotensinogen (AGT) Protein

20-abx065354
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Angiotensinogen (AGT) Antibody (HRP)

20-abx306453
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody (FITC)

20-abx306454
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody (Biotin)

20-abx306455
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiotensinogen (AGT) Antibody (Biotin)

20-abx272741
  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Angiotensinogen (AGT) Antibody (Biotin)

20-abx273211
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Angiotensinogen (AGT) Antibody (FITC)

20-abx273972
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Angiotensinogen (AGT) Antibody (FITC)

20-abx274115
  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Angiotensinogen (AGT) Protein

20-abx651467
  • EUR 648.00
  • EUR 272.00
  • EUR 1984.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Angiotensinogen (AGT) Protein

20-abx651468
  • EUR 662.00
  • EUR 272.00
  • EUR 2012.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human AGT shRNA Plasmid

20-abx950129
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AGT/Angiotensin-1 Antibody

47494-100ul 100ul
EUR 252.00

Anti-Angiotensinogen/AGT Antibody

A02103-1 100ug/vial
EUR 334.00

Human AGT ELISA Kit

ELA-E0797h 96 Tests
EUR 824.00

AGT ELISA KIT|Human

EF000352 96 Tests
EUR 689.00

AGT Antibody, HRP conjugated

1-CSB-PA001463EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AGT Antibody, FITC conjugated

1-CSB-PA001463EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AGT Antibody, Biotin conjugated

1-CSB-PA001463ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat AGT shRNA Plasmid

20-abx984365
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Angiotensinogen (AGT) Antibody Pair

20-abx370425
  • EUR 1595.00
  • EUR 1024.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Angiotensinogen (AGT) Antibody Pair

20-abx370604
  • EUR 1706.00
  • EUR 1094.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

AGT Antibody, HRP conjugated

1-CSB-PA10079B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AGT Antibody, FITC conjugated

1-CSB-PA10079C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AGT Antibody, Biotin conjugated

1-CSB-PA10079D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AGT. Recognizes AGT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

AGT Recombinant Protein (Human)

RP000778 100 ug Ask for price

Bovine AGT ELISA Kit

EBA0504 96Tests
EUR 521.00

Anserini AGT ELISA Kit

EAA0504 96Tests
EUR 521.00

Anti-Angiotensinogen/AGT Antibody

PA1643 100ug/vial
EUR 294.00

AGT Recombinant Protein (Mouse)

RP114833 100 ug Ask for price

AGT Recombinant Protein (Rat)

RP189563 100 ug Ask for price

Chicken AGT ELISA Kit

ECKA0504 96Tests
EUR 521.00

Canine AGT ELISA Kit

ECA0504 96Tests
EUR 521.00

Rat AGT ELISA Kit

ERA0504 96Tests
EUR 521.00

Sheep AGT ELISA Kit

ESA0504 96Tests
EUR 521.00

Rabbit AGT ELISA Kit

ERTA0504 96Tests
EUR 521.00

Human AGT ELISA Kit

EHA0504 96Tests
EUR 521.00

Mouse AGT ELISA Kit

EMA0504 96Tests
EUR 521.00

Porcine AGT ELISA Kit

EPA0504 96Tests
EUR 521.00

Monkey AGT ELISA Kit

EMKA0504 96Tests
EUR 521.00

Goat AGT ELISA Kit

EGTA0504 96Tests
EUR 521.00

Rat AGT ELISA Kit

STJ150346 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of AGT in Rat serum, plasma and other biological fluids

Polyclonal AGT Antibody (CT)

APG01610G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AGT (CT). This antibody is tested and proven to work in the following applications:

Anti-AGXT / AGT antibody

STJ71786 100 µg
EUR 260.00

Human Angiotensinogen (AGT) CLIA Kit

20-abx190340
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Angiotensinogen (AGT) CLIA Kit

20-abx190577
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Angiotensinogen (AGT) CLIA Kit

abx195128-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Mouse Angiotensinogen (AGT) CLIA Kit

abx195129-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Rat Angiotensinogen (AGT) CLIA Kit

abx195130-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Based on a synthesis of this research there is evidence of a knowledge gap in formal reasoning for some forensic practitioners, and a limited understanding of case-specific research. Combining these results with a review of the current literature in the field of forensic reasoning, we now offer evidence of teaching and research strategies that can help increase the epistemic status (Confidence in, and justification of knowledge) of forensic science claims